" /> EGFR NM_005228.3:c.2254_2277del24 - CISMeF





Preferred Label : EGFR NM_005228.3:c.2254_2277del24;

NCIt synonyms : Epidermal Growth Factor Receptor Gene c.2254_2277del24 EGFR c.2254_2277del24; Epidermal Growth Factor Receptor Gene c.2254_2277del24; NM_005228.3:c.2254_2277del24; NM_005228.3:c.2254_2277delTCTCCGAAAGCCAACAAGGAAATC; ERBB c.2254_2277del24; ERBB1 c.2254_2277del24; HER1 c.2254_2277del24; EGFR NM_005228.3:c.2254_2277delTCTCCGAAAGCCAACAAGGAAATC; NM_005228.3:c.2254_2277del;

NCIt definition : A deletion of 24 nucleotides from the coding sequence of the EGFR gene from position 2254 through 2277.;

SNP ID : rs121913463;

Details


You can consult :


Nous contacter.
08/10/2025


[Home] [Top]

© Rouen University Hospital. Any partial or total use of this material must mention the source.