NCIt synonyms : Protein Kinase C-Alpha Antisense; DNA, d(P-thio)(GTTCTCGCTGGTGAGTTTCA);
NCIt related terms : ISIS 3521; DNA, d(P-thio)(G-T-T-C-T-C-G-C-T-G-G-T-G-A-G-T-T-T-C-A);
NCIt definition : A synthetic phosphorothioate oligodeoxynucleotide. As an antisense molecule, aprinocarsen
hybridizes to the 3-untranslated region of the human protein kinase C (PKC-alpha)
mRNA, thereby inhibiting PKC-alpha expression and growth of PKC-alpha-dependent tumor
cells. (NCI04);
Alternative definition : NCI-GLOSS: A substance that is being studied in the treatment of cancer.;