" /> Aprinocarsen - CISMeF





Preferred Label : Aprinocarsen;

NCIt synonyms : Protein Kinase C-Alpha Antisense; DNA, d(P-thio)(GTTCTCGCTGGTGAGTTTCA);

NCIt related terms : ISIS 3521; DNA, d(P-thio)(G-T-T-C-T-C-G-C-T-G-G-T-G-A-G-T-T-T-C-A);

NCIt definition : A synthetic phosphorothioate oligodeoxynucleotide. As an antisense molecule, aprinocarsen hybridizes to the 3-untranslated region of the human protein kinase C (PKC-alpha) mRNA, thereby inhibiting PKC-alpha expression and growth of PKC-alpha-dependent tumor cells. (NCI04);

Alternative definition : NCI-GLOSS: A substance that is being studied in the treatment of cancer.;

UNII : FMT95051CQ;

CAS number : 151879-73-1; a href https://gsrs.ncats.nih.gov/ginas/app/beta/browse-substance?search 151879-73-1 alt lien vers site G-SRS target _blank img src /img/logos/logo_g-srs.png alt Logo G-SRS /a ;

Drug name : Affinitak; Affinitac;

Molecule name : LY900003; ISIS 3521; CGP 64128A;

NSC code : 719337;

Codes from synonyms : CDR0000045945; 50609;

Details


Keyword's position in hierarchy(ies) : arborescence

You can consult :


Nous contacter.
12/05/2024


[Home] [Top]

© Rouen University Hospital. Any partial or total use of this material must mention the source.