" /> Aprinocarsen - CISMeF





Preferred Label : Aprinocarsen;

NCIt synonyms : Protein Kinase C-Alpha Antisense; DNA, d(P-thio)(GTTCTCGCTGGTGAGTTTCA);

NCIt related terms : ISIS 3521; DNA, d(P-thio)(G-T-T-C-T-C-G-C-T-G-G-T-G-A-G-T-T-T-C-A);

NCIt definition : A synthetic phosphorothioate oligodeoxynucleotide. As an antisense molecule, aprinocarsen hybridizes to the 3-untranslated region of the human protein kinase C (PKC-alpha) mRNA, thereby inhibiting PKC-alpha expression and growth of PKC-alpha-dependent tumor cells. (NCI04);

Alternative definition : NCI-GLOSS: A substance that is being studied in the treatment of cancer.;

UNII : FMT95051CQ;

CAS number : 151879-73-1;

Drug name : Affinitak; Affinitac;

Molecule name : LY900003; ISIS 3521; CGP 64128A;

NSC code : 719337;

Codes from synonyms : CDR0000045945; 50609;

Details


You can consult :


Nous contacter.
01/06/2025


[Home] [Top]

© Rouen University Hospital. Any partial or total use of this material must mention the source.